Välkommen!

Deutsch
English
Français
Choose language

Riks-SMASK (uttyds Sveriges Musicerande Akademikers Samarbetande Kårorkestrar) är en förening för det 40-tal studentorkestrar (och baletter) som finns på Sveriges olika universitet och högskolor. Vår främsta uppgift är att stödja festivalkommittéerna i deras arbete med studentorkesterfestivalen. Den äger rum vartannat år i Linköping, vartannat år i Uppsala. Föreningen fungerar också som kontaktorgan mellan medlemsorkestrarna och för deras talan gentemot omvärlden då så behövs samt förvaltar arkivet över svensk studentmusik.

Vi även på Facebook och Twitter där man kan ta upp vad helst man än önskar som berör Sveriges studentorkestrar, dela bilder eller roliga idéer.

Kalendarium

Klicka på pennsymbolen till höger för att ändra på ett evenemang.

Utskriftsvänlig version

Evenemang Plats
2016-10-15 Wijkmanska Blecket 35 år! Uppsala Mer info Redigera evenemang
Wijkmanska Blecket fyller 35 år och firar med spektakulär och musikaliskt magisk show, följt av fantastisk fest med mat, dryck, musik och lycka!
Mer info kommer längre fram
2016-10-20 Studentorkestern - en musikalisk historia Uppsala Mer info Redigera evenemang
Var kommer studentorkesterfenomenet ifrån? Hur och när började det? Varför spelar vi blåsinstrument och varför har vi uniformer och medaljer? Hur kom baletten in i bilden?

Anders Carlsson (Wijkmanska Blecket) föreläser om studentorkestrarnas ursprung och historia.

Tid: Torsdag 20 oktober kl. 18.30

Plats: Uplands nation, Uppsala

Sammankomsten anordnas av Universitets- och studenthistoriska sällskapet i samarbete med Uplands nation.

Efter föreläsningen blir det sexa till nationens förmånliga pris.

Anmälan till Universitets- och studenthistoriska sällskapet. Info om anmälan kommer.

https://www.facebook.com/events/564899427049936/?notif_t=plan_user_associated&notif_id=1473251976729273

www.studenthistoriska.se
www.uplandsnation.se
2016-11-11
2016-11-12
Phontrattarnes 60-årsjubileum Uppsala Mer info Redigera evenemang
Svenska Showorkestern Phontrattarne fyller 60 år!

Välkommen att ta del av en tidsresa med favoritnummer från 50-talet fram till nutid... På scen kommer medlemmar från alla år trängas i svettig entusiasm. Vid vissa bord kommer man kunna beställa mat, och dryck kommer säljas i baren. Med andra ord - två toppenkvällar! Välkommen i november.

Plats: Katalin, Roslagsgatan , Uppsala.

Mer info om biljetter kommer. Gilla gärna Phontrattarnes facebooksida om du vill hålla dig uppdaterad!
2016-11-19 Blåslagets årliga konsert! Stockholm, Solna Mer info Redigera evenemang
Blåslagets årliga konsert heter i år "Storslaget"! Namnet beskriver väl hur det kommer vara, just storslaget! Baletten Dragplåstret har 30-års jubileum vilket kommer firas med dans både på scen och resten av kvällen!
Platsen är Medicinska föreningen på Karolinska institutet i Solna.
Efter konserten kommer det ske en sittning och efter detta fest natten lång!
Kom och dela denna kväll med oss!
2016-11-26 Kårsdragets Höstkonsert Stockholm Redigera evenemang
2017-05-11
2017-05-14
SOF Linköping Mer info Redigera evenemang
Studentorkesterfestivalen 2017 närmar sig med stormsteg. Ändå har vi knappt ork(an)en att vänta!

Mer information kommer i höst, men låt oss inte bris(ta) i vår kommunikation. Hör av er till orkester-ljud@sof17.se om ni har frågor redan nu.

Så kom igen, var en kuling och taggataggataggataggataggataggatagga!

Lägg till evenemang

*Datum

ÅÅÅÅ-MM-DD

Endast stad räcker. Lokal passar bättre i info-fältet.

Lämna tomt för att inte tillåta någon redigering.

Ifall du glömmer lösenordet.